pCRII-Topo Foxp2 in situ probe
(Plasmid #45620)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al Neuron. 2005 Sep 15;47(6):817-31.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4400
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Foxp2 in situ probe
• Alt name: Foxp2
• Alt name: forkhead-related transcription factor 2
• Species: M. musculus (mouse)
• Mutation: fragment contains bp#1709-2142 of AF339106
• GenBank ID: AF339106
• Entrez Gene: Foxp2 (a.k.a. 2810043D05Rik, CAG-16, D0Kist7)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 F

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Fox2p fragment was amplified by RT-PCR using the following primer pair:
CAGTGTGGACTGTGGACGAA
TTCCAGGTCCTCAGATAAAGG

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication.