pGL3 BRE Luciferase
(Plasmid #45126)

• Depositing Labs: Martine Roussel, Peter ten Dijke
• Publication: Korchynskyi et al J Biol Chem. 2002 Feb 15;277(7):4883-91. Epub 2001 Nov 29.

Backbone

• Vector backbone: pGL3-Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Vector type: Mammalian Expression, Luciferase ; BMP/Smad Transcriptional Reporter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Id1-BRE
• Alt name: BRE-Luc reporter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: RVprimer3
• 3′ sequencing primer: LucNRev

Resource Information

• Articles Citing this Plasmid:
  • 27 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Synthetic oligonucleotides containing two CAGC sites, GGCGCC palindrome and MluI 5′-overhang (on the sense strand) and two SBE sites, one GGCG site and NheI 5′-overhang (on the antisense strand) were ligated and inserted into NheI sites in pGL3-MLP-luc minimal promoter vector. Thus the construct was created with a 5′ site for NheI site followed by 2 SBEs, 1 GGCG site, 2 CAGC′ sites, 2 GGCGCC palindromes, 2 CAGC′ sites, 1 GGCG site, 2 SBEs, and an NheI 3′ site.

Based on the above description and the associated publication, the deduced sequence of the full hairpin is:
GCTAGCTCAGACCGTTAGACGCCAGGACGGGCTGTCAGGCTGGCGCCG CGGCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAGCTAGC

The presence of the hairpin can make sequencing this region difficult by traditional Sanger Sequencing. Protocols for "difficult templates" or "GC rich" may help.