pKG209
(Plasmid #45109)

• Depositing Lab: Iain Cheeseman
• Publication: Gascoigne et al Cell. 2011 Apr 29;145(3):410-22. doi: 10.1016/j.cell.2011.03.031.

Backbone

• Vector backbone: pIC242
• Backbone size w/o insert (bp): 6000
• Modifications to backbone: pIC242 backbone, insert has been codon optimized
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CENP-T (aa1-374) Laci-NLS
• Species: H. sapiens (human)
• Entrez Gene: CENPT (a.k.a. C16orf56, CENP-T, SSMGA)
• Tags / Fusion Proteins:
  • GFP (N terminal on backbone)
  • tev (N terminal on backbone)
  • s peptide (N terminal on insert)
  • Laci-NLS (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho1 (unknown if destroyed)
• 3′ cloning site: EcoR1/Sac11 (unknown if destroyed)
• 5′ sequencing primer: GGCATGGACGAGCTGTACAAG
• 3′ sequencing primer: GCATTCATTTTATGTTTCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry