pGEN-luxCDABE
(Plasmid #44918)

• Depositing Lab: Harry Mobley
• Publication: Lane et al Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9.

Backbone

• Vector backbone: pGENlux
• Backbone manufacturer: M. Chelsea Lane
• Backbone size w/o insert (bp): 11000
• Total vector size (bp): 11119
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sigma 70 promoter
• Alt name: em7
• Species: synthetic construct
• Insert Size (bp): 200
• Promoter: em7
• Tag / Fusion Protein:
  • lux transcriptional fusion

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: SnaBI (not destroyed)
• 5′ sequencing primer: CATATGAAGCTTGGTACCGGGATC
• 3′ sequencing primer: CTTTCGGGAAAGATTTCAACCTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: James Galen, Ph.D. University of Maryland
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

original source is pGEN222