pDN-D2irTNG4kwh
(Plasmid #44722)

• Depositing Lab: Gabor Balazsi
• Publication: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471.

Backbone

• Vector backbone: pcDNA4/TO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5078
• Total vector size (bp): 7446
• Modifications to backbone: CMV-2xTetO promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and WPRE inserted before and after insert, respectively.
• Vector type: Mammalian Expression, Synthetic Biology ; Expression regulator/reporter; Expression "Linearizer" system
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: pCMV-D2i promoter
• Alt name: Modified CMV-based synthetic promoter containing two tetO2 sites
• Species: Synthetic
• Insert Size (bp): 672
• Mutation: Initiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
• Promoter: pCMV-D2i

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: AflII (not destroyed)
• 5′ sequencing primer: Amp-R
• 3′ sequencing primer: Bglob-intron-R (TTTGCCCCCTCCATATAACA)

Gene/Insert 2

• Gene/Insert name: htetR::NLS::EGFP
• Alt name: humanized tetracycline repressor
• Alt name: Simian virus 40 (SV40) large-T-antigen nuclear localization sequence
• Alt name: Enhanced green fluorescent protein
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2481
• Mutation: Region around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
• Tags / Fusion Proteins:
  • Rabbit β-globin intron II (N terminal on insert)
  • WPRE (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
• 3′ sequencing primer: EGFP-N; WPRE-R, BGH-rev

Resource Information

• Supplemental Documents:
  • pDN-D2irTNG4kwh.PDW
• A portion of this plasmid was derived from a plasmid made by: Fragment containing humanized htetR gene from pTet-OFF Advanced plasmid (Clontech). Mammalian codon optimized variant of eGFP gene from the pIRES2-EGFP plasmid (Clontech). Rabbit β-globin intron II-containing fragment from plasmid pcDNA6/TR (Invitrogen). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry