-
PurposeCo-expression of human codon-optimized Cas9 (D10A) mutant nickase and GFP, plasmid optimized for expression in human pluripotent stem cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4200
- Total vector size (bp) 9271
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9D10A-2A-GFP
-
SpeciesSynthetic
-
Insert Size (bp)4926
-
MutationD10A mutation- nickase mutant
- Promoter CAG
-
Tag
/ Fusion Protein
- 2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggctctagtgcctctgctaacc
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeorge Church
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Musunuru Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Musunuru/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9D10A_GFP was a gift from Kiran Musunuru (Addgene plasmid # 44720 ; http://n2t.net/addgene:44720 ; RRID:Addgene_44720) -
For your References section:
Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Ding Q, Regan SN, Xia Y, Oostrom LA, Cowan CA, Musunuru K. Cell Stem Cell. 2013 Apr 4;12(4):393-4. doi: 10.1016/j.stem.2013.03.006. 10.1016/j.stem.2013.03.006 PubMed 23561441