pCas9_GFP
(Plasmid #44719)

• Purpose: Co-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells
• Depositing Lab: Kiran Musunuru
• Publication: Ding et al Cell Stem Cell. 2013 Apr 4;12(4):393-4. doi: 10.1016/j.stem.2013.03.006.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4200
• Total vector size (bp): 9271
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9-2A-GFP
• Species: Synthetic
• Insert Size (bp): 4926
• Promoter: CAG
• Tag / Fusion Protein:
  • 2A-GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: ggctctagtgcctctgctaacc
• 3′ sequencing primer: M13R

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: George Church
• Articles Citing this Plasmid:
  • 151 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For more information on Musunuru Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Musunuru/