Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pActinin-TagRFP675-N1
(Plasmid #44278)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44278 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pN1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6640
  • Total vector size (bp) 7357
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP675
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Mutation
    M41Q/F80W/S143N/L147M/S158N/D159Y/N173S
  • Promoter CMV
  • Tag / Fusion Protein
    • Actinin (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer cggtaggcgtgtacggtgggag
  • 3′ sequencing primer gttcagggggaggtgtgggagg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pActinin-TagRFP675-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 44278 ; http://n2t.net/addgene:44278 ; RRID:Addgene_44278)
  • For your References section:

    Extended Stokes shift in fluorescent proteins: chromophore-protein interactions in a near-infrared TagRFP675 variant. Piatkevich KD, Malashkevich VN, Morozova KS, Nemkovich NA, Almo SC, Verkhusha VV. Sci Rep. 2013;3:1847. doi: 10.1038/srep01847. 10.1038/srep01847 PubMed 23677204