pTagRFP675-actin-C1
(Plasmid #44277)

• Depositing Lab: Vladislav Verkhusha
• Publication: Piatkevich et al Sci Rep. 2013;3:1847. doi: 10.1038/srep01847.

Backbone

• Vector backbone: pN1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5072
• Total vector size (bp): 5814
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TagRFP675
• Species: Synthetic
• Insert Size (bp): 742
• Mutation: M41Q/F80W/S143N/L147M/S158N/D159Y/N173S
• Promoter: CMV
• Tag / Fusion Protein:
  • Actin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: cggtaggcgtgtacggtgggag
• 3′ sequencing primer: gttcagggggaggtgtgggagg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry