EGFR-ET1
(Plasmid
#44185)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES2-EGFP
-
Backbone manufacturerBD Biosciences Clontech
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 9000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFR-ET1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3870
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3C cleavge site, protein C peptide tag, his6, SBP tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TTGGCACCAAAATCAACGGGACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid expresses full-length, mature human EGFR (amino acids 1−1186) and does not include the 24aa signal peptide sequence in GenBank reference sequence NP_005219.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFR-ET1 was a gift from Timothy Springer (Addgene plasmid # 44185 ; http://n2t.net/addgene:44185 ; RRID:Addgene_44185) -
For your References section:
Functional and structural stability of the epidermal growth factor receptor in detergent micelles and phospholipid nanodiscs. Mi LZ, Grey MJ, Nishida N, Walz T, Lu C, Springer TA. Biochemistry. 2008 Sep 30;47(39):10314-23. doi: 10.1021/bi801006s. Epub 2008 Sep 5. 10.1021/bi801006s PubMed 18771282
Map uploaded by the depositor.