Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMALp2x-SCO5461
(Plasmid #42507)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42507 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAL-p2x
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6715
  • Total vector size (bp) 7330
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Growth instructions
    Use rich media (terrific broth, etc.) for protein expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    guanosine ADP-ribosyltransferase
  • Alt name
    SCO5461
  • Alt name
    ScARP
  • Alt name
    NAD+:guanine-N2-ADP-D-ribosyltransferase
  • Species
    Streptomyces coelicolor A3(2)
  • Insert Size (bp)
    615
  • GenBank ID
    AL939123.1:267130..267744 CAB76015.1
  • Entrez Gene
    SCO5461 (a.k.a. SCO5461, SC3D11.18)
  • Promoter tac
  • Tag / Fusion Protein
    • maltose-binding protein (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ggtcgtcagactgtcgatgaagcc
  • 3′ sequencing primer gtaaaacgacggccag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMALp2x-SCO5461 was a gift from Koji Okamoto (Addgene plasmid # 42507 ; http://n2t.net/addgene:42507 ; RRID:Addgene_42507)
  • For your References section:

    ADP-ribosylation of guanosine by SCO5461 protein secreted from Streptomyces coelicolor. Nakano T, Matsushima-Hibiya Y, Yamamoto M, Takahashi-Nakaguchi A, Fukuda H, Ono M, Takamura-Enya T, Kinashi H, Totsuka Y. Toxicon. 2012 Dec 2;63C:55-63. doi: 10.1016/j.toxicon.2012.11.019. 10.1016/j.toxicon.2012.11.019 PubMed 23212047