-
PurposeExpresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineering
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA_GFP-T1
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/
gRNA target sequence GTGAACCGCATCGAGCTGAA
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA_GFP-T1 was a gift from George Church (Addgene plasmid # 41819 ; http://n2t.net/addgene:41819 ; RRID:Addgene_41819) -
For your References section:
RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM. Science. 2013 Feb 15;339(6121):823-6. doi: 10.1126/science.1232033 10.1126/science.1232033 PubMed 23287722
