pRLuc110UGA
(Plasmid #41729)

• Depositing Lab: James Inglese
• Publication: Auld et al Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3585-90. Epub 2009 Feb 10.

Backbone

• Vector backbone: pRL-CMV
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4079
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RLuc110UGA
• Alt name: renilla luciferase
• Insert Size (bp): 861
• Mutation: in-frame UGA stop codon at codon 110 in the open reading frame of the RLuc cDNA
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCTAGAGTACTTAATACGACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This construct was prepared and sequenced by GenScript Coporation.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry