pRLuc110UGA
(Plasmid
#41729)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRL-CMV
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4079
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRLuc110UGA
-
Alt namerenilla luciferase
-
Insert Size (bp)861
-
Mutationin-frame UGA stop codon at codon 110 in the open reading frame of the RLuc cDNA
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTAGAGTACTTAATACGACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis construct was prepared and sequenced by GenScript Coporation.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRLuc110UGA was a gift from James Inglese (Addgene plasmid # 41729 ; http://n2t.net/addgene:41729 ; RRID:Addgene_41729) -
For your References section:
Mechanism of PTC124 activity in cell-based luciferase assays of nonsense codon suppression. Auld DS, Thorne N, Maguire WF, Inglese J. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3585-90. Epub 2009 Feb 10. 10.1073/pnas.0813345106 PubMed 19208811