pFLuc190UGA
(Plasmid
#41046)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRL-CMV
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 4884
-
Modifications to backboneReplaced the Renilla reniformas luciferase (Rluc) gene found in pRL-CMV with that of P. pyralis from pGL3-Basic
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase 190UGA
-
Mutationin-frame UGA stop codon was created at codon 190
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCTAGAGTACTTAATACGACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis construct was prepared and sequenced by GenScript Corporation.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A mutation that produced an in-frame UGA stop codon was created at codon 190 in the FLuc coding region of pFLucWT to produce the construct reffered to as pFLuc190UGA (mutation at codon 190; 571AC->TG).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFLuc190UGA was a gift from James Inglese (Addgene plasmid # 41046 ; http://n2t.net/addgene:41046 ; RRID:Addgene_41046) -
For your References section:
Mechanism of PTC124 activity in cell-based luciferase assays of nonsense codon suppression. Auld DS, Thorne N, Maguire WF, Inglese J. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3585-90. Epub 2009 Feb 10. 10.1073/pnas.0813345106 PubMed 19208811