- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepEGFP-C1
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 8453
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namePICH
- 
                  Alt nameERCC6L
- 
                  Alt nameexcision repair cross-complementing rodent repair deficiency, complementation group 6-like
- 
                  Alt nameRAD26L
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)3753
- 
                    GenBank IDNM_017669.2 BC111486.1
- 
                        Entrez GeneERCC6L (a.k.a. PICH, RAD26L)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - eGFP (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer EGFP-C; CMV-F
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byPICH ORF amplified from a HeLa Marathon library (Clontech laboratories Inc.)
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pEGFP PICH (Nigg CB62) was a gift from Erich Nigg (Addgene plasmid # 41163 ; http://n2t.net/addgene:41163 ; RRID:Addgene_41163)
- 
                For your References section: PICH, a centromere-associated SNF2 family ATPase, is regulated by Plk1 and required for the spindle checkpoint. Baumann C, Korner R, Hofmann K, Nigg EA. Cell. 2007 Jan 12;128(1):101-14. 10.1016/j.cell.2006.11.041 PubMed 17218258
