pEGFP PICH (Nigg CB62)
(Plasmid #41163)

• Depositing Lab: Erich Nigg
• Publication: Baumann et al Cell. 2007 Jan 12;128(1):101-14.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 8453
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PICH
• Alt name: ERCC6L
• Alt name: excision repair cross-complementing rodent repair deficiency, complementation group 6-like
• Alt name: RAD26L
• Species: H. sapiens (human)
• Insert Size (bp): 3753
• GenBank ID: NM_017669.2 BC111486.1
• Entrez Gene: ERCC6L (a.k.a. PICH, RAD26L)
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: EGFP-C; CMV-F
• 3′ sequencing primer: BGH-rev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PICH ORF amplified from a HeLa Marathon library (Clontech laboratories Inc.)
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.