pCDNA4/BDD-FVIII
(Plasmid #41035)

• Depositing Lab: Robert Peters
• Publication: Peters et al J Thromb Haemost. 2012 Dec 4. doi: 10.1111/jth.12076.

Backbone

• Vector backbone: pCDNA4
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5030
• Total vector size (bp): 9401
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: B domain deleted FVIII
• Alt name: BDD-FVIII
• Species: H. sapiens (human)
• Insert Size (bp): 4374
• Mutation: B domain deletion
• GenBank ID: NM_000132
• Entrez Gene: F8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATAGGGAGACCCAAGCTGGC
• 3′ sequencing primer: CGAATGGGTGACCTCGAGCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry