pAraTM-2BTMCYL980A
(Plasmid
#39550)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTrc99
- Backbone size w/o insert (bp) 5611
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntegrin alpha2B L980A TM-CYTO
-
SpeciesSynthetic
-
Insert Size (bp)138
- Promoter Tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ATG CCA TAG CAT TTT TAT CC
- 3′ sequencing primer AAGCTTTTATGACAACTTGACGGCTACATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAraTM-2BTMCYL980A was a gift from Bryan Berger (Addgene plasmid # 39550 ; http://n2t.net/addgene:39550 ; RRID:Addgene_39550) -
For your References section:
Identifying Key Juxtamembrane Interactions in Cell Membranes Using AraTM. Su PC, Berger BW. J Biol Chem. 2012 Jul 22. 10.1074/jbc.M112.396895 PubMed 22822084