pAraTMwt
(Plasmid
#47514)
-
PurposeContains A2B L980A TMCY mutant, expresses wt AraC for heterodimer competition assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTrc99
- Total vector size (bp) 5611
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntegrin alpha2B L980A TM-CYTO
-
SpeciesSynthetic
-
Insert Size (bp)138
- Promoter Tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gcgctgaagtcttacgagga
- 3′ sequencing primer TTATGACAACTTGACGGCTACATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Addgene QC sequence identifed a S23P mutation in the MBP insert that does not effect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAraTMwt was a gift from Bryan Berger (Addgene plasmid # 47514 ; http://n2t.net/addgene:47514 ; RRID:Addgene_47514) -
For your References section:
A Novel Assay for Assessing Juxtamembrane and Transmembrane Domain Interactions Important for Receptor Heterodimerization. Su PC, Berger BW. J Mol Biol. 2013 Jul 19. pii: S0022-2836(13)00456-7. doi: 10.1016/j.jmb.2013.07.022. 10.1016/j.jmb.2013.07.022 PubMed 23876708