pET11a-4SS-HEWL
(Plasmid #39233)

• Depositing Lab: Harald Schwalbe
• Publication: Schlorb et al J Biomol NMR. 2005 Oct;33(2):95-104.

Backbone

• Vector backbone: pET11a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5641
• Total vector size (bp): 6034
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Hen egg white lysozyme
• Alt name: HEWL
• Species: G. gallus (chicken)
• Insert Size (bp): 393
• Mutation: N-terminal Met
• GenBank ID:
• Entrez Gene: LYZ (a.k.a. LYZC, dystrophin)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GGGTTATGCTAGTTATTGCTCAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry