SV-ABAactDA
(Plasmid #38247)

• Depositing Lab: Jerry Crabtree
• Publication: Liang et al Sci Signal. 2011 Mar 15;4(164):rs2.

Backbone

• Vector backbone: pUC
• Backbone manufacturer: homemade
• Backbone size w/o insert (bp): 2944
• Total vector size (bp): 2944
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: VP16/PYL1
• Species: A. thaliana (mustard weed)
• Promoter: SV40p
• Tags / Fusion Proteins:
  • VP16 (N terminal on insert)
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe1 (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: GTGAGCGGATAACAATTTCAC
• 3′ sequencing primer: CCC TCA CAT TGC CAA AAG AC

Gene/Insert 2

• Gene/Insert name: Gal4DBD/ABI*
• Species: A. thaliana (mustard weed)
• Mutation: D143A
• Promoter: SV40 (IRES)
• Tags / Fusion Proteins:
  • Gal4DBD (N terminal on insert)
  • Flag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: GCACATGCTTTACATGTGTTTAG
• 3′ sequencing primer: gtg agc gga taa caa ttt cac

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are minor sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in backbone region only and should not affect function.