-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPEP-TEV
- Backbone size w/o insert (bp) 2968
- Total vector size (bp) 4460
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNucleoporin 98
-
Alt nameNup98
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1515
-
Mutationamino acids 1-498
-
Entrez GeneNUP98 (a.k.a. ADIR2, NUP196, NUP96, Nup98-96)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag, 3Cysteine (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCGGATCCTGTTGCTGTTTTAACAAATCATTTGGAACA
- 3′ sequencing primer CCGGAATTCTTAAGAGTCTCCAAAAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypPEP-TEV empty plasmid was obtained from Prof. H. Herrmann and used to derive our plasmid (pPEP-TEV/cNup98)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
see also:
Strelkov, S. V., Kreplak, L., Herrmann, H. & Aebi, U. (2004). Methods Cell Biol.78, 25–43.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPEP-TEV cNup98 (1-498) was a gift from Roderick Lim (Addgene plasmid # 38037 ; http://n2t.net/addgene:38037 ; RRID:Addgene_38037) -
For your References section:
Single-molecule transport across an individual biomimetic nuclear pore complex. Kowalczyk SW, Kapinos L, Blosser TR, Magalhaes T, van Nies P, Lim RY, Dekker C. Nat Nanotechnol. 2011 Jun 19;6(7):433-8. doi: 10.1038/nnano.2011.88. 10.1038/nnano.2011.88 PubMed 21685911