pEGFP-NUP188
(Plasmid #159893)

• Purpose: Expresses NUP188 in mammalian cells
• Depositing Lab: Kozo Tanaka
• Publication: Itoh et al Cancer Sci. 2013 Jul;104(7):871-9. doi: 10.1111/cas.12159. Epub 2013 May 2.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech (TaKaRa)
• Backbone size w/o insert (bp): 3965
• Total vector size (bp): 9204
• Modifications to backbone: Kanamycin-resistant gene was replaced with ampicillin-resistant gene, and the multi-cloning site was also replaced.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NUP188
• Alt name: Nucleoporin 188
• Species: H. sapiens (human)
• Insert Size (bp): 5239
• Mutation: To avoid NotI site, first three amino acids are deleted, amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP (Please see depositor comments)
• GenBank ID: NM_015354.3
• Entrez Gene: NUP188 (a.k.a. KIAA0169, SANDSTEF, hNup188)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CATTTTATGTTTCAGGTTCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS had amino acids RHPS (at position 1051 to 1054) deleted and K206A on EGFP, but depositor confirms that these discrepancies do not have any functional significance on the plasmid.