Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ss-cfSGFP2
(Plasmid #37535)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37535 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4105
  • Total vector size (bp) 4825
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ss-cfSGFP2 (cysteine-free SGFP2)
  • Alt name
    cfSGFP2 with a signal sequence of a1-antitrypsin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    873
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • signal sequence of α1-antitrypsin (M1-K34) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCAGAGCTGGTTTAGTGAACCGTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is used for expression of cfSGFP2 in the ER. The cleaved signal sequence of α1-antitrypsin (M1-K34) was fused to the N-terminus of SGFP2 using BglII and EcoRI sites. The fragment M1-A24 should be removed cotranslationally after translocation. The long flanking sequence E25-K34 of α1-antitrypsin was included to ensure access to signal peptidase

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ss-cfSGFP2 was a gift from Ikuo Wada (Addgene plasmid # 37535 ; http://n2t.net/addgene:37535 ; RRID:Addgene_37535)
  • For your References section:

    Development of cysteine-free fluorescent proteins for the oxidative environment. Suzuki T, Arai S, Takeuchi M, Sakurai C, Ebana H, Higashi T, Hashimoto H, Hatsuzawa K, Wada I. PLoS One. 2012;7(5):e37551. Epub 2012 May 23. 10.1371/journal.pone.0037551 PubMed 22649538