ss-cfSGFP2
(Plasmid #37535)

• Depositing Lab: Ikuo Wada
• Publication: Suzuki et al PLoS One. 2012;7(5):e37551. Epub 2012 May 23.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4105
• Total vector size (bp): 4825
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ss-cfSGFP2 (cysteine-free SGFP2)
• Alt name: cfSGFP2 with a signal sequence of a1-antitrypsin
• Species: H. sapiens (human)
• Insert Size (bp): 873
• GenBank ID:
• Promoter: CMV
• Tag / Fusion Protein:
  • signal sequence of α1-antitrypsin (M1-K34) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCAGAGCTGGTTTAGTGAACCGTCAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is used for expression of cfSGFP2 in the ER. The cleaved signal sequence of α1-antitrypsin (M1-K34) was fused to the N-terminus of SGFP2 using BglII and EcoRI sites. The fragment M1-A24 should be removed cotranslationally after translocation. The long flanking sequence E25-K34 of α1-antitrypsin was included to ensure access to signal peptidase