Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BD2
(Plasmid #37486)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37486 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR2.1-TOPO
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 17461
  • Vector type
    iPSC gene targeting
  • Selectable markers
    Hygromycin ; TK

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    loxP-PGK-Hyg-loxP
  • Alt name
    floxed PGK-Hyg
  • Species
    Synthetic
  • Insert Size (bp)
    2161
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer cgtggatgaagttggtggtg
  • 3′ sequencing primer aggcagagagagtcagtgcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BD2 was a gift from Linzhao Cheng (Addgene plasmid # 37486 ; http://n2t.net/addgene:37486 ; RRID:Addgene_37486)
  • For your References section:

    Site-specific gene correction of a point mutation in human iPS cells derived from an adult patient with sickle cell disease. Zou J, Mali P, Huang X, Dowey SN, Cheng L. Blood. 2011 Oct 27;118(17):4599-608. Epub 2011 Aug 31. 10.1182/blood-2011-02-335554 PubMed 21881051