-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6500
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerabies virus glycoprotein
-
Insert Size (bp)1575
-
GenBank IDEU126641.1
- Promoter CAGGs
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atggttcctcaggttctttt (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG RABV-G was a gift from Connie Cepko (Addgene plasmid # 36398 ; http://n2t.net/addgene:36398 ; RRID:Addgene_36398) -
For your References section:
Anterograde or retrograde transsynaptic labeling of CNS neurons with vesicular stomatitis virus vectors. Beier KT, Saunders A, Oldenburg IA, Miyamichi K, Akhtar N, Luo L, Whelan SP, Sabatini B, Cepko CL. Proc Natl Acad Sci U S A. 2011 Sep 13;108(37):15414-9. Epub 2011 Aug 8. 10.1073/pnas.1110854108 PubMed 21825165