pRRL WS1.6 GFP
(Plasmid #36249)

• Depositing Lab: David Rawlings
• Publication: Astrakhan et al Blood. 2012 Mar 19.

Backbone

• Vector backbone: pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
• Backbone manufacturer: Didier Trono
• Backbone size w/o insert (bp): 6857
• Total vector size (bp): 8524
• Modifications to backbone: PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of promoter CDS cassettes
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GFP
• Alt name: EGFP
• Alt name: enhanced green fluorescent protein
• Insert Size (bp): 720
• Entrez Gene: eGFP (a.k.a. pPRS3a_01)
• Promoter: WAS (human 1.6 kb)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gatcacgagactagcctcgag
• 3′ sequencing primer: caacgggccacaactcctc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone is from Addgene plasmid 12252 (Didier Trono)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry