-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 6857
- Total vector size (bp) 7332
-
Modifications to backbonePGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of MND GFP cassette
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameenhanced green fluorescent protein
-
Alt nameEGFP
-
Insert Size (bp)720
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter MND
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gatcacgagactagcctcgag
- 3′ sequencing primer caacgggccacaactcctc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone is from Addgene plasmid 12252 (Didier Trono)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL MND GFP was a gift from David Rawlings (Addgene plasmid # 36247 ; http://n2t.net/addgene:36247 ; RRID:Addgene_36247) -
For your References section:
Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569