Skip to main content
Addgene

pRRL MND WASp
(Plasmid #36248)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36248 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 6857
  • Total vector size (bp) 8134
  • Modifications to backbone
    PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of promoter CDS cassettes
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    WASp
  • Alt name
    Wiskott-Aldrich Syndrome Protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1509
  • Entrez Gene
    WAS (a.k.a. IMD2, SCNX, THC, THC1, WASP, WASPA)
  • Promoter MND

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gatcacgagactagcctcgag
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone is from Addgene plasmid 12252 (Didier Trono)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL MND WASp was a gift from David Rawlings (Addgene plasmid # 36248 ; http://n2t.net/addgene:36248 ; RRID:Addgene_36248)
  • For your References section:

    Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569