Skip to main content
Addgene

pZHY501
(Plasmid #36187)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36187 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCP4
  • Total vector size (bp) 7498
  • Modifications to backbone
    Golden Gate compatible (see Cermak, et al., 2011) expression vector for TALENs. TAL-DNA binding domain can be removed via BamHI and XbaI digestion.
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homodimeric FokI Nuclease
  • Mutation
    delta152,+63 truncation to TAL backbone
  • Promoter TEV
  • Tag / Fusion Protein
    • ACV5 (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttggcgtcggcaaacagtgg
  • 3′ sequencing primer ttaaaagtttatctcaccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that there are some minor discrepancies between the Addgene quality control sequence and the sequence from the depositor. These differences will not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY501 was a gift from Daniel Voytas (Addgene plasmid # 36187 ; http://n2t.net/addgene:36187 ; RRID:Addgene_36187)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327