Skip to main content
Addgene

pZHY500
(Plasmid #36186)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36186 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCP3
  • Total vector size (bp) 6561
  • Modifications to backbone
    Golden Gate compatible (see Cermak, et al., 2011) expression vector for TALENs. TAL-DNA binding domain can be removed via BamHI and XbaI digestion.
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FokI homodimeric Nuclease domain
  • Mutation
    delta152,+63 truncation to TAL backbone
  • Promoter TEV
  • Tag / Fusion Protein
    • ACV5 (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atcgcgcaatgcactgacgggtg
  • 3′ sequencing primer ttaaaagtttatctcaccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY500 was a gift from Daniel Voytas (Addgene plasmid # 36186 ; http://n2t.net/addgene:36186 ; RRID:Addgene_36186)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327