-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2817
- Total vector size (bp) 4344
-
Vector typeEntry vector for expression in plants as a T2A linked polycistronic message
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHeterodimeric FokI nuclease
-
Alt nameT2A
- Promoter none
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cagctggtgaagtccgagctgg
- 3′ sequencing primer gttattaaatttccgtctcacttcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZHY013 was a gift from Daniel Voytas (Addgene plasmid # 36185 ; http://n2t.net/addgene:36185 ; RRID:Addgene_36185) -
For your References section:
TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327