Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTALE64G
(Plasmid #35188)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35188 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7009
  • Modifications to backbone
    Addition of TALE Transcription Factor motif with +63 C Terminus and VP64 domain. Also includes a T2A skip peptide followed by GFP under control of the same CMV promoter.
  • Vector type
    Mammalian Expression, TALEN
  • Selectable markers
    Neomycin (select with G418) ; XGAL/IPTG

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB + Antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAL Effector-VP64-T2A-eGFP
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    1581
  • Mutation
    +63 C Terminus, VP64 Domain, T2A-GFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
  • 3′ sequencing primer CGTCCACCAAGACATGCCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We modified the MR15 backbone provided by the Porteus lab at the Stanford University School of Medicine.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MR15 is a designation vector for the Cermak et al Golden Gate system designed for expression in mammalian cells.

Please acknowledge the principal investigator, Dr. Gang Bao, and include this article in your citations if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35188" in your Materials and Methods section.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTALE64G was a gift from Gang Bao (Addgene plasmid # 35188 ; http://n2t.net/addgene:35188 ; RRID:Addgene_35188)