pmCherry-C1-FAK-HA
(Plasmid #35039)

• Depositing Lab: Anna Huttenlocher
• Publication: Chan et al J Biol Chem. 2010 Apr 9;285(15):11418-26. Epub 2010 Feb 11.

Backbone

• Vector backbone: pmCherry-c1
• Backbone manufacturer: BD Clontech
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: focal adhesion kinase
• Alt name: FAK
• Species: M. musculus (mouse)
• Insert Size (bp): 3150
• Mutation: Y42H; deletion of amino acids 1051 & 1052
• Entrez Gene: Ptk2 (a.k.a. FADK 1, FAK, FRNK, Fadk, p125FAK)
• Tags / Fusion Proteins:
  • mCherry (N terminal on insert)
  • 2x HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl 2 (not destroyed)
• 3′ cloning site: Kpn 1 (not destroyed)
• 5′ sequencing primer: GACAGATCTATGGCAGCTGCTTATCTTGACCCAAAC
• 3′ sequencing primer: 5' GTAGGTACCTTATCTAGATCCGGTGGATC 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Murine GFP-FAK (pEGFP-C1-FAK-HA) was provided by D. Schlaepfer (University of California San Diego).
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing result identified a Y42H mutation when compared to the full plasmid sequence provided by the depositing laboratory and to GenBank entry NP_032008.2.

The final two FAK amino acids are missing in this construct, as the original source for the FAK construct used in this plasmid was originally missing these same amino acids. The depositing laboratory states that the deletion should not affect any FAK function since it is outside of the FAK primary sequence.

Addgene's sequencing results also identified a deletion region from bp#4553-4588 when compared to the full plasmid sequence provided by the depositing laboratory. This indicates that the restriction sites KpnI (4561), SacII (4564) and ApaI (4569) are not present in the vector.