Nurr1
(Plasmid #35000)

• Depositing Lab: Malin Parmar
• Publication: Pfisterer et al Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6.

Backbone

• Vector backbone: pCCL-cppt-PGK-WPRE
• Backbone manufacturer: Malin Parmar
• Backbone size w/o insert (bp): 7041
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Nuclear receptor subfamily 4 group A member 2
• Alt name: Nurr1
• Alt name: Nr4a2
• Species: M. musculus (mouse)
• Insert Size (bp): 1797
• GenBank ID: NT_039206.7
• Entrez Gene: Nr4a2 (a.k.a. HZF-3, NOT, Nurr1, RNR-1, TINOR, TINUR)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CGGTTTCAGAAGTGCCTAGC
• 3′ sequencing primer: CCTCTCCGGCCTTTTAAACT

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry