pQTEV-NOHMA
(Plasmid #34821)

• Depositing Lab: Konrad Buessow
• Publication: Bussow et al Microb Cell Fact. 2005 Jul 5. 4():21.

Backbone

• Vector backbone: pQTEV
• Backbone size w/o insert (bp): 4700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Rosetta
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HORMA domain containing protein
• Alt name: PSFEp250F083
• Alt name: NOHMA
• Species: H. sapiens (human)
• Insert Size (bp): 1236
• GenBank ID: CAB66689 DQ000561
• Entrez Gene: HORMAD1 (a.k.a. CT46, NOHMA)
• Tags / Fusion Proteins:
  • His (N terminal on backbone)
  • TEV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: GGCAACCGAGCGTTCTGAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.

The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.