pLV.PGK.mFoxa2
(Plasmid #33014)

• Depositing Lab: Malin Parmar
• Publication: Pfisterer et al Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6.

Backbone

• Vector backbone: pCCL-cppt-PGK-WPRE
• Backbone manufacturer: Malin Parmar
• Backbone size w/o insert (bp): 7041
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Forkhead box A2
• Alt name: Foxa2
• Species: M. musculus (mouse)
• Insert Size (bp): 1380
• Mutation: H10L
• GenBank ID: NM_010446.2 (see note below)
• Entrez Gene: Foxa2 (a.k.a. HNF3-beta, HNF3beta, Hnf-3b, Hnf3b, Tcf-3b, Tcf3b)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GACATACCGACGCAGCTACA
• 3′ sequencing primer: CCGGTAGAAAGGGAAGAGGT

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing data shows a H10L mutation is present compared to the depositor's sequence. This mutation is a known variant of mouse Foxa2 (GenBank: CAA52891.1).