Skip to main content
Addgene

pCMV-HA (New MCS)
(Plasmid #32530)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32530 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 3800
  • Modifications to backbone
    Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.
  • Vector type
    Mammalian Expression
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag.

Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA (New MCS) was a gift from Christopher A Walsh (Addgene plasmid # 32530 ; http://n2t.net/addgene:32530 ; RRID:Addgene_32530)
Related items:
Commonly requested with: