Skip to main content
Addgene

pAAV-GFP
(Plasmid #32395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32395 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pSub201
  • Backbone size w/o insert (bp) 8310
  • Vector type
    Mammalian Expression, AAV ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Users must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) A SmaI digest should produce the following pattern of bands: 3654 bp, 1716 bp and 1500 bp. (2) An AhdI digest should produce the following pattern of bands: 3183 bp, 2582 bp and 1127 bp. Please consult the associated publication listed below for an example gel image.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Multiple (see map) (not destroyed)
  • 3′ cloning site Multiple (see map) (not destroyed)
  • 5′ sequencing primer GGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
  • 3′ sequencing primer GGCCAGGGCATTAGCCACACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see Notes from Addgene link above for Addgene's diagnostic digests of this plasmid with AhdI and SmaI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-GFP was a gift from John T Gray (Addgene plasmid # 32395 ; http://n2t.net/addgene:32395 ; RRID:Addgene_32395)
  • For your References section:

    Design and Construction of Functional AAV Vectors. Gray JT, Zolotukhin S. Methods Mol Biol. 2011;807:25-46. 10.1007/978-1-61779-370-7_2 PubMed 22034025