pMito-LSSmKate1-N1
(Plasmid #31878)

• Depositing Lab: Vladislav Verkhusha
• Publication: Piatkevich et al Proc Natl Acad Sci U S A. 2010 Mar 23;107(12):5369-74. Epub 2010 Mar 8.

Backbone

• Vector backbone: N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4646
• Modifications to backbone: LSS-mKate1 insert
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human cytochrome C oxidase subunit VIII
• Species: H. sapiens (human)
• Insert Size (bp): 95
• Mutation: K69Y/P131T/S148G/M167E/T183S/M196V compared to mKate but numbering is relative to EGFP
• Entrez Gene: COX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ggtaggcgtgtacggtgggag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry