Skip to main content
Addgene

pMXs-B1
(Plasmid #31705)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31705 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXs
  • Backbone size w/o insert (bp) 4600
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-106a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    441

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gacggcatcgcagcttggat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-B1 was a gift from Duanqing Pei (Addgene plasmid # 31705 ; http://n2t.net/addgene:31705 ; RRID:Addgene_31705)
  • For your References section:

    MicroRNA cluster 302-367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition. Liao B, Bao X, Liu L, Feng S, Zovoilis A, Liu W, Xue Y, Cai J, Guo X, Qin B, Zhang R, Wu J, Lai L, Teng M, Niu L, Zhang B, Esteban MA, Pei D. J Biol Chem. 2011 May 13. 286(19):17359-64. 10.1074/jbc.C111.235960 PubMed 21454525