Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-EGFP/RFP-miR-Scrint
(Plasmid #19821)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19821 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG-EGFP/RFP-int
  • Backbone size w/o insert (bp) 8200
  • Vector type
    Mammalian Expression, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scrambled miRNA
  • Insert Size (bp)
    400

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GCTGGACATCACCTCCCACAACG
  • 3′ sequencing primer ACAGGAGGTGGGGAGCAGGAGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).

miR-Scr:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-EGFP/RFP-miR-Scrint was a gift from Zuoshang Xu (Addgene plasmid # 19821 ; http://n2t.net/addgene:19821 ; RRID:Addgene_19821)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 . 8():77. 10.1186/1472-6750-8-77 PubMed 18840295