pFB-GluCl_cryst
(Plasmid #31488)

• Depositing Lab: Eric Gouaux
• Publication: Hibbs et al Nature. 2011 Jun 2. 474(7349):54-60.

Backbone

• Vector backbone: pFastbac1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4800
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha, LB/Amp100
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C. elegans glutamate-gated chloride channel alpha, crystallized construct
• Alt name: GluCl
• Alt name: GluCl_cryst
• Species: C. elegans (nematode)
• Insert Size (bp): 1100
• Tag / Fusion Protein:
  • 8x-His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ccaccatcgggcgcggatcc
• 3′ sequencing primer: ggttttttaaagcaagtaaaacc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Henry Lester, Caltech
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry