Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEM-GluCl_cryst
(Plasmid #31487)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31487 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-HE, modified
  • Backbone size w/o insert (bp) 3000
  • Vector type
    For RNA synthesis for expression in X. laevis oocytes

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB / Amp100
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    C. elegans glutamate-gated chloride channel alpha, crystallized construct
  • Alt name
    GluCl
  • Alt name
    GluCl_cryst
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1100
  • Tag / Fusion Protein
    • 8x-His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggtaacgccagggttttccc
  • 3′ sequencing primer gtaagttggtattatgtagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Henry Lester, Caltech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For vector information, see: Liman et al. 1992 Neuron 9:861-871.

For RNA synthesis, linearize plasmid with NheI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-GluCl_cryst was a gift from Eric Gouaux (Addgene plasmid # 31487 ; http://n2t.net/addgene:31487 ; RRID:Addgene_31487)
  • For your References section:

    Principles of activation and permeation in an anion-selective Cys-loop receptor. Hibbs RE, Gouaux E. Nature. 2011 Jun 2. 474(7349):54-60. 10.1038/nature10139 PubMed 21572436