pDEST-HemmarG
(Plasmid #31221)

• Depositing Lab: Yuh-Nung Jan
• Publication: Han et al Proc Natl Acad Sci U S A. 2011 May 23. ():.

Backbone

• Vector backbone: pAPIC-HIH
• Backbone size w/o insert (bp): 10193
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: ccdB Survival™ 2 T1R Cells @ 37C.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD4-tdGFP
• Species: H. sapiens (human), D. melanogaster (fly); Aequorea victoria
• Insert Size (bp): 2340
• Mutation: Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, EGFP, GFP, and Kir2.1 ER exit signal.
• Entrez Gene: CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
• Tags / Fusion Proteins:
  • CD4 (N terminal on insert)
  • EGFP/GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ACTGCAACTACTGAAATCTGCC
• 3′ sequencing primer: GGCGCACAGAAATGATTACAAC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdGFP

The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)