Skip to main content
Addgene

pDEST-HemmarR
(Plasmid #31222)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAPIC-HIH
  • Backbone size w/o insert (bp) 10193
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    ccdB Survival™ 2 T1R Cells @ 37C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4-tdTom
  • Alt name
    CD4-tdTomato
  • Species
    H. sapiens (human), D. melanogaster (fly); Aequorea victoria
  • Insert Size (bp)
    2271
  • Mutation
    Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, tdTomato, and Kir2.1 ER exit signal.
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
  • Tags / Fusion Proteins
    • CD4 (N terminal on insert)
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ACTGCAACTACTGAAATCTGCC
  • 3′ sequencing primer GGCGCACAGAAATGATTACAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdTom

The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-HemmarR was a gift from Yuh-Nung Jan (Addgene plasmid # 31222 ; http://n2t.net/addgene:31222 ; RRID:Addgene_31222)
  • For your References section:

    Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han C, Jan LY, Jan YN. Proc Natl Acad Sci U S A. 2011 May 23. ():. 10.1073/pnas.1106386108 PubMed 21606367