Skip to main content
Addgene

pTAL4
(Plasmid #31035)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDW1789_Leu
  • Backbone size w/o insert (bp) 6519
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a/LB+antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN-FokI nuclease backbone
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    1948
  • Tags / Fusion Proteins
    • FokI nuclease (C terminal on insert)
    • AcV5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TEF_seq (ggtcttcaatttctcaagtttc) TAL_F1 (ttggcgtcggcaaacagtgg)
  • 3′ sequencing primer homodimer_rev (aattcagatttcactagctg) TAL_R2 (ggcgacgaggtggtcgttg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression of the TAL-FokI homodimer in yeast.

NOTE: The GenBank file associated with this plasmid (accessible from the Golden Gate TALEN kit page) erroneously lists this plasmid as having a D450A codon (A--C) FokI mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTAL4 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31035 ; http://n2t.net/addgene:31035 ; RRID:Addgene_31035)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687