pBOB-synP-HT
(Plasmid #30456)

• Depositing Lab: Edward Callaway
• Publication: Edward Callaway plasmids (unpublished)

Backbone

• Vector backbone: pCSC-SP-PW-GFP
• Backbone manufacturer: Addgene plasmid 12337
• Backbone size w/o insert (bp): 8000
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: histone GFP
• Alt name: nuclear GFP, histone H2B-eGFP
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: AscI, PmeI (unknown if destroyed)
• 5′ sequencing primer: human synapsin I promoter (CCACTGGACAAGCACCCAAC)
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry