AAV-CAG-hChR2-H134R-tdTomato
(Plasmid #28017)

• Purpose: AAV-mediated expression of hChR2(H134R) for neuronal excitation.
• Depositing Lab: Karel Svoboda
• Publication: Mao et al Neuron. 2011 Oct 6;72(1):111-23.

Backbone

• Vector backbone: AAV2/1
• Backbone size w/o insert (bp): 4761
• Vector type: AAV ; adeno associate viral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: humanized ChR2-H134R-tdTomato
• Alt name: hChR-2H134R-tdTomato
• Insert Size (bp): 2363
• Mutation: H134R
• Promoter: CAG
• Tag / Fusion Protein:
  • tdTomato

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TCGGCTTCTGGCGTGTGACCGG

Resource Information

• Articles Citing this Plasmid:
  • 21 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

With ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.

Note that though there is a point mutation in the tdTomato, it does not affect fluorescence.

Information for AAV Retrograde (Catalog # 28017-AAVrg)

Purpose

Ready-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA.

Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV retrograde (AAVrg)
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.