Amber N1
(Plasmid #27798)

• Depositing Lab: Steven Vogel
• Publication: Koushik et al Biophys J. 2006 Dec 15. 91(12):L99-L101.

Backbone

• Vector backbone: mVenus N1
• Backbone manufacturer: Addgene plasmid# 27793
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mAmber N1
• Insert Size (bp): 720

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Amber was created by mutating Tyrosine 67 in Venus to Cysteine (Y67C).

See Addgene's sequencing results for detailed MCS and Amber. This plasmid is designed to clone a gene of interest upstream and in-frame to create a C-terminal Amber fusion protein.