-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 27793-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $105 |
Backbone
-
Vector backbonepEYFP N1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus N1
-
Alt namemVenus-N1
-
Insert Size (bp)720
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was created by mutagenesis of pEYFP-N1. When compared with EYFP, Venus contains the following mutations: F46L, F64L, M153T, V163A and S175G. This construct also contains A206K mutation to create a monomeric form of the fluorescent protein.
This plasmid contains a MCS upstream of mVenus so that a gene of interest can be cloned to create a fusion protein with a C-terminal mVenus tag.
Information for Cloning Grade DNA (Catalog # 27793-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mVenus N1 was a gift from Steven Vogel (Addgene plasmid # 27793 ; http://n2t.net/addgene:27793 ; RRID:Addgene_27793) -
For your References section:
Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988